MethPrimer - Design Primers for Methylation PCRs

Home Protocols

Resources

FAQ Help

Primer Design Rules for Methylation Mapping Experiments

 

  1. Bisulfite sequencing PCR (BSP) or restriction PCR.
    1. Primers should not contain CpG sites within their sequence to ensure unbiased amplification of both methylated or unmethylated DNA.
    2. Primers should have an adequate number of no-CpG 'C's in their sequence to amplify only the bisulfite modified DNA. Primers with more no-CpG 'C's will be preferred.
    3. If CpG island prediction is not used for primer selection (default), PCR products must span a minimum number of CpG sites specified by the user (default: 5).
  2. Methylation-Specific PCR (MSP)
    1. Primers should contain at least one CpG site within their sequence, and the CpG site should preferably be located in the very 3-end of their sequence to discriminate maximally methylated DNA against unmethylated DNA.
    2. Primers should have an adequate number of no-CpG 'C's in their sequence to amplify only the bisulfite modified DNA. Primers with more no-CpG 'C's will be preferred.
    3. Primers for methylated DNA (M pair) and for unmethylated DNA (U pair) should contain the same CpG sites within their sequence. For example, a forward primer in the M pair has this sequence: ATTAGTTTCGTTTAAGGTTCGA, the forward primer in the U pair must also contain the two CpG sites, e.g., ATTAGTTTTGTTTAAGGTTTGA. But they may differ in length and start position.
    4. The M pair and U pair should preferably have a similar annealing temperature.
  3. CpG island predication and primer design
    1. If CpG island prediction is used for primer design and more than one island is found, any of the predicted islands can be a target region for primer selection.
    2. If a CpG island size is smaller than the minimum product size, the primer pair should span the whole island.
    3. If a CpG island size is greater than the maximum product size, the primer pair should be within the island.
    4. If a CpG island size is between the minimum and maximum product size, at least two thirds of the island region should be amplified.