|
Primer Design Rules for Methylation Mapping Experiments
- Bisulfite
sequencing PCR (BSP) or restriction PCR.
- Primers
should not contain CpG sites within their sequence to ensure unbiased
amplification of both methylated or unmethylated DNA.
- Primers should have an adequate
number of no-CpG 'C's in
their sequence to amplify only the bisulfite modified DNA. Primers with more
no-CpG 'C's will be preferred.
- If
CpG island prediction is not used for primer selection (default), PCR
products must span a minimum number of CpG sites specified by the user
(default: 5).
- Methylation-Specific PCR (MSP)
- Primers should contain at least one CpG site within their
sequence, and the CpG site should preferably be located in the very 3’-end
of their sequence to discriminate maximally methylated DNA against unmethylated DNA.
- Primers should have an adequate
number of no-CpG 'C's in
their sequence to amplify only the bisulfite modified DNA. Primers with more
no-CpG 'C's will be preferred.
- Primers for methylated DNA
(M pair) and for unmethylated DNA (U pair) should
contain the same CpG sites within their sequence. For example, a forward
primer in the M pair has this sequence: ATTAGTTTCGTTTAAGGTTCGA,
the forward primer in the U pair must also contain the two CpG
sites, e.g., ATTAGTTTTGTTTAAGGTTTGA. But they may differ in length and
start position.
- The M pair and U pair should preferably have
a similar annealing temperature.
- CpG island predication and primer design
- If
CpG island prediction is used for primer design and more than one island
is found, any of the predicted islands can be a target region for primer
selection.
- If a
CpG island size is smaller than the minimum product size, the primer pair
should span the whole island.
- If a
CpG island size is greater than the maximum product size, the primer pair
should be within the island.
- If a
CpG island size is between the minimum and maximum product size, at least
two thirds of the island region should be
amplified.
|